Molecular Basis of InheritanceMedium

Question

Nucleotide arrangement in DNA can be seen by

Options

A.X-ray crystallography
B.electron microscope
C.ultracentrifuge
D.light microscope

Solution

Astbury by his X-ray diffraction studies suggested 3 - D configuration for DNA molecules which was confirmed by Wilkins and Franklin in 1952 and then in 1953 Watson and Crick designed the model of DNA molecule.

Create a free account to view solution

View Solution Free
Topic: Molecular Basis of Inheritance·Practice all Molecular Basis of Inheritance questions

More Molecular Basis of Inheritance Questions

Which one of the following is the starter codon?...All of the following are part of an operon except :-...Which one is the correct product of DNA dependent RNA polymerase to the given template?3'TACATGGCAAATATCCATTCA5'...What would happen if in a gen encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA?...Taylor conducted the experiments to prove semiconservative mode of chromosome replication on...